
A Bioinspired Elastic Hydrogel for Solar-Driven Water Purification

A Bioinspired Elastic Hydrogel for Photo voltaic-Pushed Water Purification

The worldwide demand for clear and secure water will proceed to develop effectively into the 21st century. Transferring ahead, the dearth of entry to wash water, which threatens human well being and strains valuable power assets, will worsen because the local weather modifications. Due to this fact, future improvements that produce potable water from contaminated sources should be sustainable. Impressed by nature, a photo voltaic absorber gel (SAG) is developed to purify water from contaminated sources utilizing solely pure daylight.
The SAG consists of an elastic thermoresponsive poly(N-isopropylacrylamide) (PNIPAm) hydrogel, a photothermal polydopamine (PDA) layer, and a sodium alginate (SA) community. Manufacturing of the SAG is facile; all processing is aqueous-based and happens at room temperature. Remarkably, the SAG can purify water from numerous dangerous reservoirs containing small molecules, oils, metals, and pathogens, utilizing solely daylight.
The SAG depends on photo voltaic power to drive a hydrophilic/hydrophobic part transformation on the decrease crucial resolution temperature. Because the purification mechanism doesn’t require water evaporation, an energy-intensive course of, the passive photo voltaic water-purification charge is the best reported. This discovery could be transformative within the sustainable manufacturing of fresh water to enhance the standard of human life.

Contribution of bacterial extracellular polymeric substances (EPS) in floor water purification

Naturally current aquatic microorganisms play an vital position in water purification programs, such because the self-purification of floor waters. On this research, two water sources representing polluted floor water (Olympic Inexperienced; OG) and unpolluted floor water (Jingmi river; JM), have been used to discover the self-purification of floor water by micro organism beneath totally different environmental situations.
The dominant bacterial group of OG and JM waters (each are Firmicutes and Proteobacteria) have been remoted, cultured, after which used to hold out flocculation assessments. Outcomes confirmed that the flocculation ability of the dominant micro organism and extracellular polymeric substances (EPS) obtained from OG isolation was considerably better than that from JM. Additional examination illustrated that the principle parts of EPS have been polysaccharides, which performed an vital position in enhancing the flocculation capability of micro organism.
EPS from dominant cultural micro organism strains (OG1 and JM3) remoted from the 2 totally different sources lacked hydrophilic teams (e.g. COOH) and had a networked construction that are the principle causes to reinforce the flocculation capability.
The bacterial variety and redundancy evaluation (RDA) outcomes additionally confirmed that microbial group composition is decided by water high quality (SS, TOC, and NH4+), and totally different Bacteroidetes, Actinobacteria and Proteobacteria group constructions can enhance the water physique’s capability to take away environmental pollution (comparable to SS, humic acid and fulvic acid). These findings present new info displaying how bacterial communities change with environmental elements whereas sustaining the purity of floor water.
Mouse Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx255269-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Pig Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx255449-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx256809-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Rabbit Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx256993-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Dog Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx250005-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Human Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx252900-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Canine CKMB(Creatine Kinase MB Isoenzyme) ELISA Kit
ECA0005 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Alias: CKMB(Creatine Kinase MB Isoenzyme)/CK-MB
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Canine;Sensitivity: 0.094 ng/ml
Chicken Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx355524-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx364238-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Human Creatine Kinase MB Isoenzyme (CKMB) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Creatine Kinase MB Isoenzyme (CKMB) CLIA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Creatine Kinase MB Isoenzyme (CKMB) CLIA Kit
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Porcine CKMB(Creatine Kinase MB Isoenzyme) ELISA Kit
EP0035 96T
EUR 567.6
  • Detection range: 0.234-15 ng/ml
  • Alias: CKMB(Creatine Kinase MB Isoenzyme)/CK-MB
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Pig;Sensitivity: 0.141 ng/ml
Human Creatine Kinase MB Isoenzyme ELISA Kit (CKMB)
RK01118 96 Tests
EUR 521
Human Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Creatine Kinase MB Isoenzyme elisa. Alternative names of the recognized antigen: CK2
  • CK-MB
  • Creatine Kinase, Muscle/Brain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Creatine Kinase MB Isoenzyme (CKMB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Mu-10x96wellstestplate 10x96-wells test plate
EUR 3919.92
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Mu-1x48wellstestplate 1x48-wells test plate
EUR 410.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Mu-1x96wellstestplate 1x96-wells test plate
EUR 543.52
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Mu-5x96wellstestplate 5x96-wells test plate
EUR 2145.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates and other biological fluids.
Mouse Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
  • EUR 3970.00
  • EUR 2096.00
  • EUR 544.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Creatine Kinase MB Isoenzyme elisa. Alternative names of the recognized antigen: CK2
  • CK-MB
  • Creatine Kinase, Muscle/Brain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Creatine Kinase MB Isoenzyme (CKMB) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Ra-10x96wellstestplate 10x96-wells test plate
EUR 4129.36
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Ra-1x48wellstestplate 1x48-wells test plate
EUR 427.71
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Ra-1x96wellstestplate 1x96-wells test plate
EUR 568.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
SEA479Ra-5x96wellstestplate 5x96-wells test plate
EUR 2256.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Creatine Kinase MB Isoenzyme (CKMB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Creatine Kinase MB Isoenzyme (CKMB) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Rat Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
  • EUR 4180.00
  • EUR 2207.00
  • EUR 569.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Creatine Kinase MB Isoenzyme elisa. Alternative names of the recognized antigen: CK2
  • CK-MB
  • Creatine Kinase, Muscle/Brain
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Creatine Kinase MB Isoenzyme (CKMB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Creatine Kinase MB Isoenzyme ELISA Kit (CKMB)
RK02688 96 Tests
EUR 521
Rat Creatine Kinase MB Isoenzyme ELISA Kit (CKMB)
RK03571 96 Tests
EUR 521
Human CKMB(Creatine Kinase MB Isoenzyme)ELISA Kit
STJ150510 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CKMB in human serum, plasma and other biological fluids
CLIA kit for Human CKMB (Creatine Kinase MB Isoenzyme)
E-CL-H0921 1 plate of 96 wells
EUR 584
  • Gentaur's CKMB CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CKMB . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CKMB (Creatine Kinase MB Isoenzyme) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human CKMB (Creatine Kinase MB Isoenzyme)
E-EL-H1434 1 plate of 96 wells
EUR 534
  • Gentaur's CKMB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CKMB. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CKMB (Creatine Kinase MB Isoenzyme) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse CKMB (Creatine Kinase MB Isoenzyme)
E-EL-M0355 1 plate of 96 wells
EUR 534
  • Gentaur's CKMB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CKMB. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CKMB (Creatine Kinase MB Isoenzyme) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat CKMB (Creatine Kinase MB Isoenzyme)
E-EL-R1327 1 plate of 96 wells
EUR 534
  • Gentaur's CKMB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CKMB. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CKMB (Creatine Kinase MB Isoenzyme) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rabbit CKMB (Creatine Kinase MB Isoenzyme)
E-EL-RB0057 1 plate of 96 wells
EUR 584
  • Gentaur's CKMB ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit CKMB. Standards or samples are added to the micro ELISA plate wells and combined with t
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rabbit CKMB (Creatine Kinase MB Isoenzyme) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat CKMB (Creatine Kinase MB Isoenzyme)
ELK2693 1 plate of 96 wells
EUR 432
  • The microplate provided in this kit has been pre-coated with an antibody specific to CKMM. Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to CKBB. Next, Avidin conjugated to Ho
  • Show more
Description: A sandwich ELISA kit for detection of Creatine Kinase MB Isoenzyme from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human CKMB (Creatine Kinase MB Isoenzyme)
ELK5085 1 plate of 96 wells
EUR 432
  • The microplate provided in this kit has been pre-coated with an antibody specific to CKMM. Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to CKBB. Next, Avidin conjugated to Ho
  • Show more
Description: A sandwich ELISA kit for detection of Creatine Kinase MB Isoenzyme from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Mouse CKMB (Creatine Kinase MB Isoenzyme)
ELK1286 1 plate of 96 wells
EUR 372
  • The microplate provided in this kit has been pre-coated with an antibody specific to CKMM. Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to CKBB. Next, Avidin conjugated to Ho
  • Show more
Description: A sandwich ELISA kit for detection of Creatine Kinase MB Isoenzyme from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Guinea pig Creatine Kinase MB Isoenzyme (CKMB) ELISA Kit
abx357689-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
CKMB ELISA Kit| Rabbit Creatine Kinase MB Isoenzyme ELISA Kit
EF016788 96 Tests
EUR 689
CKMB ELISA Kit| Porcine Creatine Kinase MB Isoenzyme ELISA Kit
EF016576 96 Tests
EUR 689
Creatine Kinase MB Isoenzyme (CK-MB) Antibody
abx020737-1mg 1 mg
EUR 871
  • Shipped within 5-10 working days.
Creatine Kinase MB Isoenzyme (CK-MB) Antibody
abx020739-1mg 1 mg
EUR 523
  • Shipped within 5-10 working days.
Creatine Kinase MB Isoenzyme (CK-MB) Antibody
abx020740-1mg 1 mg
EUR 523
  • Shipped within 5-10 working days.
Creatine Kinase MB Isoenzyme (CK-MB) Antibody
abx020741-1mg 1 mg
EUR 704
  • Shipped within 5-10 working days.
Creatine Kinase MB Isoenzyme (CK-MB) Antibody
abx020742-1mg 1 mg
EUR 704
  • Shipped within 5-10 working days.
Creatine Kinase Isoenzyme MB Assay Kit
abx098421-Hitachi7060R160ml8R260ml2 Hitachi 7060; R1: 60ml×8 R2: 60ml×2
EUR 237
  • Shipped within 5-12 working days.
Creatine Kinase Isoenzyme MB Assay Kit
abx098421-Hitachi7170R124ml1R26ml1 Hitachi 7170; R1: 24ml×1 R2: 6ml×1
EUR 237
  • Shipped within 5-12 working days.
Creatine Kinase Isoenzyme MB Assay Kit
abx098421-Hitachi7170R140ml2R220ml1 Hitachi 7170; R1: 40ml×2 R2: 20ml×1
EUR 378
  • Shipped within 5-12 working days.
Creatine Kinase Isoenzyme MB Assay Kit
abx098421-Hitachi7170R160ml1R215ml1 Hitachi 7170; R1: 60ml×1 R2: 15ml×1
EUR 331
  • Shipped within 5-12 working days.
Human Creatine Kinase MB isoenzyme,CK-MB ELISA Kit
201-12-0939 96 tests
EUR 440
  • This Creatine Kinase MB isoenzyme ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Creatine Kinase MB isoenzyme, CK-MB ELISA Kit
CSB-E05140h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Creatine Kinase MB isoenzyme, CK-MB in samples from serum, plasma, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Creatine Kinase MB isoenzyme, CK-MB ELISA Kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Creatine Kinase MB isoenzyme, CK-MB in samples from serum, plasma, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Pig creatine kinase MB isoenzyme (CK-MB) ELISA kit
CSB-EQ027653PI-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig creatine kinase MB isoenzyme (CK-MB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Pig creatine kinase MB isoenzyme (CK-MB) ELISA kit
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig creatine kinase MB isoenzyme (CK-MB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rabbit creatine kinase MB isoenzyme (CK-MB) ELISA kit
CSB-EQ027653RB-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit creatine kinase MB isoenzyme (CK-MB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rabbit creatine kinase MB isoenzyme (CK-MB) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit creatine kinase MB isoenzyme (CK-MB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Creatine Kinase MB Isoenzyme (CK-MB) CLIA Kit
abx195424-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Creatine Kinase MB Isoenzyme (CK-MB) CLIA Kit
abx195425-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Creatine Kinase MB isoenzyme, CK-MB ELISA Kit
CSB-E14403r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Creatine Kinase MB isoenzyme, CK-MB in samples from serum, urine, tissue homogenates, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Creatine Kinase MB isoenzyme, CK-MB ELISA Kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Creatine Kinase MB isoenzyme, CK-MB in samples from serum, urine, tissue homogenates, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Creatine Kinase MB isoenzyme, CK-MB ELISA Kit
CSB-E14404m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Creatine Kinase MB isoenzyme, CK-MB in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Creatine Kinase MB isoenzyme, CK-MB ELISA Kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Creatine Kinase MB isoenzyme, CK-MB in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Canine Creatine Kinase MB isoenzyme (CK-MB)ELISA Kit
CSB-E15852c-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Canine Creatine Kinase MB isoenzyme (CK-MB) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Canine Creatine Kinase MB isoenzyme (CK-MB)ELISA Kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Canine Creatine Kinase MB isoenzyme (CK-MB) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Creatine Kinase MB isoenzyme,CK-MB ELISA Kit
CN-04036H1 96T
EUR 461
Human Creatine Kinase MB isoenzyme,CK-MB ELISA Kit
CN-04036H2 48T
EUR 310
Mouse CK-MB(Creatine Kinase MB Isoenzyme) ELISA Kit
EM0929 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Alias: CK-MB/CKMB(Creatine Kinase MB Isoenzyme)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml
Rat CK-MB(Creatine Kinase MB Isoenzyme) ELISA Kit
ER0841 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Alias: CK-MB
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 18.75pg/ml
Human Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
GA-E0955HM-48T 48T
EUR 289
Human Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
GA-E0955HM-96T 96T
EUR 466
Rat Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
GA-E0319RT-48T 48T
EUR 317
Rat Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
GA-E0319RT-96T 96T
EUR 496
Mouse Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
GA-E0320MS-48T 48T
EUR 336
Mouse Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
GA-E0320MS-96T 96T
EUR 534
Human Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
QY-E03021 96T
EUR 361
Rat Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
QY-E11333 96T
EUR 361
Mouse Creatine Kinase MB isoenzyme(CK-MB)ELISA Kit
QY-E20398 96T
EUR 361
Rat CK-MB(Creatine Kinase MB Isoenzyme) ELISA Kit
STJ150415 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CK-MB in Rat serum, plasma and other biological fluids
Human Creatine Kinase MB isoenzyme ELISA kit
E01C0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Creatine Kinase MB isoenzyme ELISA kit
E01C0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Creatine Kinase MB isoenzyme ELISA kit
E01C0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Creatine Kinase MB isoenzyme ELISA kit
E03C0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Creatine Kinase MB isoenzyme ELISA kit
E03C0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Creatine Kinase MB isoenzyme ELISA kit
E03C0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Creatine Kinase MB isoenzyme ELISA kit
E06C0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Creatine Kinase MB isoenzyme ELISA kit
E06C0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Creatine Kinase MB isoenzyme ELISA kit
E06C0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Creatine Kinase MB isoenzyme ELISA kit
E04C0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Creatine Kinase MB isoenzyme ELISA kit
E04C0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Creatine Kinase MB isoenzyme ELISA kit
E04C0085-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Creatine Kinase MB isoenzyme ELISA kit
E02C0085-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Creatine Kinase MB isoenzyme ELISA kit
E02C0085-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Creatine Kinase MB isoenzyme in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guar gum primarily based nanocomposites: Function in water purification via environment friendly removing of dyes and metallic ions

Researchers these days are relentlessly on a race exploring sustainable supplies and strategies for the sequestration of poisonous dyes and metallic ions from water our bodies. Biopolymers comparable to guar gum, owing to its excessive abundance, low price and non-toxicity, are potential candidates on this area. Loads of hydroxyl teams within the polymer spine allow guar gum to be functionalised or grafted in a flexible method proving itself as a superb beginning substance for fabricating upgraded supplies meant for various functions.
This evaluate gives a complete protection of the position of guar gum-based nanocomposites in removing of dyes and heavy metallic ions from waste water via adsorption and photo-catalytic degradation. Isotherm and kinetics fashions, fabrication routes, characterisation strategies, swelling properties and reusability in addition to adsorption and degradation mechanisms are outlined. An in depth evaluation with convincing outcomes suggests a great future perspective of implementation of those supplies in real-time wastewater remedy expertise.

Single-use microfluidic gadget for purification and focus of environmental DNA from river water

Purification and focus of DNA is a crucial step on DNA-based evaluation, which ought to guarantee environment friendly DNA isolation and efficient removing of contaminants that will intervene with downstream DNA amplification. Complexity of samples, minute content material of goal analyte, or excessive DNA fragmentation drastically entangles the success of this step. To beat this challenge, we designed and fabricated a novel miniaturized disposable gadget for a extremely environment friendly DNA purification.
The microfluidic gadget confirmed binding effectivity and elution yield of 90.1% and 86.7%, respectively. Furthermore, the impact of DNA fragmentation, a parameter that has not been beforehand addressed, confirmed an awesome impression within the restoration step. The microfluidic system built-in micropillars with chitosan getting used because the solid-phase for a pH-dependent DNA seize and launch.
Now we have confirmed the potential of the gadget within the profitable purification of environmental DNA (eDNA) from river water samples contaminated with Dreissena polymorpha, an invasive alien species accountable for unquestionable financial and environmental penalties in river water basins.
Moreover, the gadget was additionally capable of focus the DNA extract from extremely diluted samples, displaying promising outcomes for the early detection of such invasive species, which can enable immediate measures for a extra environment friendly management in affected areas. Suitability for integration with downstream DNA evaluation was additionally demonstrated via qPCR evaluation of the samples purified with the microfluidic gadget, permitting detection of the goal species even when extremely diluted.
  1. Quite a few contaminants in enormous quantities are discharged to the surroundings from numerous anthropogenic actions. Waterbodies are one of many main receivers of those contaminants. The contaminated water can pose severe threats to people and animals, by distrubing the ecosystem.
  2. In treating the contaminated water, adsorption processes have attained vital maturity as a result of decrease price, straightforward operation and environmental friendliness. The adsorption course of makes use of numerous adsorbent materi
  3. These hybrid magnetic nanocomposites have attained intensive functions in water remedy applied sciences as a result of their magnetic properties in addition to mixture of distinctive traits of natural and inorganic parts. Carbon- and polymer-related magnetic nanocomposites are extra tailored supplies for the removing of assorted sorts of contaminants from waterbodies.
  4. These nanocomposites could be produced through totally different approaches comparable to filling, pulse-laser irradiation, ball milling, and electro-spinning. This complete evaluate is compiled by reviewing printed work of final the most recent current three years.
  5. The evaluate article extensively focuses on totally different approaches for producing numerous carbon- and polymer-based magnetic nanocomposites, their deserves and demerits and functions for sustainable water purification. Extra particularly, use of carbon- and polymer-based magnetic nanocomposites for removing of heavy metallic ions and dyes is mentioned intimately, critically analyzed and in contrast with different applied sciences.
  6. As well as, business viability when it comes to regeneration of adsorbents can also be reviewed. Moreover, the long run challenges and prospects in using magnetic nanocomposites for contaminant removing from numerous water sources are offered.

mRNA-Decapping Enzyme 1B (DCP1B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1B (DCP1B) Antibody

abx232270-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human mRNA-decapping enzyme 1B (DCP1B)

  • EUR 1298.00
  • EUR 682.00
  • EUR 798.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 81.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human mRNA-decapping enzyme 1B(DCP1B) expressed in in vitro E.coli expression system

Mouse mRNA- decapping enzyme 1B, Dcp1b ELISA KIT

ELI-28140m 96 Tests
EUR 865

Human mRNA-Decapping Enzyme 1B (DCP1B) ELISA Kit

abx386810-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine mRNA- decapping enzyme 1B, DCP1B ELISA KIT

ELI-32403b 96 Tests
EUR 928

Human mRNA- decapping enzyme 1B, DCP1B ELISA KIT

ELI-48379h 96 Tests
EUR 824

DCP1B antibody

70R-16758 50 ul
EUR 435
Description: Rabbit polyclonal DCP1B antibody

DCP1B Antibody

DF12929 200ul
EUR 304
Description: DCP1B Antibody detects endogenous levels of DCP1B.

DCP1B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DCP1B. Recognizes DCP1B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DCP1B antibody

70R-8999 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal DCP1B antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27678 50 ug
EUR 363
Description: Mouse polyclonal to DCP1B

DCP1B Blocking Peptide

33R-9166 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DCP1B antibody, catalog no. 70R-8999

DCP1B Blocking Peptide

DF12929-BP 1mg
EUR 195

DCP1B cloning plasmid

CSB-CL811635HU-10ug 10ug
EUR 629
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1857
  • Sequence: atggcagccgtggcggcaggcggcctggtgggaaaggggcgcgacatcagcctagcggccctgcagcgccacgacccctatatcaaccgcatcgtggacgtggccagccaggtggctctgtacaccttcggccatcgggccaacgagtgggagaaaactgatgtggaaggaacct
  • Show more
Description: A cloning plasmid for the DCP1B gene.

anti- DCP1B antibody

FNab02270 100µg
EUR 548.75
  • Immunogen: DCP1 decapping enzyme homolog B(S. cerevisiae)
  • Uniprot ID: Q8IZD4
  • Gene ID: 196513
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DCP1B

Anti-DCP1B antibody

PAab02270 100 ug
EUR 386

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-100ug

QP9835-ye-100ug 100ug
EUR 670

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-10ug

QP9835-ye-10ug 10ug
EUR 308

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-1mg

QP9835-ye-1mg 1mg
EUR 2747

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-200ug

QP9835-ye-200ug 200ug
EUR 1069

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-500ug

QP9835-ye-500ug 500ug
EUR 1804

Recombinant Human mRNA-decapping enzyme 1B Protein, His, Yeast-50ug

QP9835-ye-50ug 50ug
EUR 417

Human mRNA-decapping enzyme 1A (DCP1A)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human mRNA-decapping enzyme 1A(DCP1A) expressed in E.coli

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx010640-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx216929-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (Dcp1a) Antibody

abx037749-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx029355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx029355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx331753-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

MRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx432194-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

mRNA-Decapping Enzyme 1A (DCP1A) Antibody

abx232269-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.


EF009027 96 Tests
EUR 689

Human DCP1B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCP1B Recombinant Protein (Human)

RP008836 100 ug Ask for price

DCP1B Recombinant Protein (Mouse)

RP128126 100 ug Ask for price

Recombinant Human mRNA-decapping enzyme 1B Protein, His-B2M, Invitro-E.coli-100ug

QP9835-iv-100ug 100ug
EUR 1613

Recombinant Human mRNA-decapping enzyme 1B Protein, His-B2M, Invitro-E.coli-10ug

QP9835-iv-10ug 10ug
EUR 816

Recombinant Human mRNA-decapping enzyme 1B Protein, His-B2M, Invitro-E.coli-50ug

QP9835-iv-50ug 50ug
EUR 516

DCP1B ORF Vector (Human) (pORF)

ORF002946 1.0 ug DNA
EUR 95

Dcp1b ORF Vector (Mouse) (pORF)

ORF042710 1.0 ug DNA
EUR 506

Human mRNA- decapping enzyme 2, DCP2 ELISA KIT

ELI-09113h 96 Tests
EUR 824

Mouse mRNA- decapping enzyme 1A, Dcp1a ELISA KIT

ELI-26330m 96 Tests
EUR 865

Mouse mRNA- decapping enzyme 2, Dcp2 ELISA KIT

ELI-26523m 96 Tests
EUR 865

Human mRNA-Decapping Enzyme 1A (DCP1A) ELISA Kit

abx386809-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human mRNA- decapping enzyme 1A, DCP1A ELISA KIT

ELI-47012h 96 Tests
EUR 824

DCP1B sgRNA CRISPR Lentivector set (Human)

K0566401 3 x 1.0 ug
EUR 339

Dcp1b sgRNA CRISPR Lentivector set (Mouse)

K3596801 3 x 1.0 ug
EUR 339

Human Scavenger mRNA- decapping enzyme DcpS, DCPS ELISA KIT

ELI-08941h 96 Tests
EUR 824

Bovine Scavenger mRNA- decapping enzyme DcpS, DCPS ELISA KIT

ELI-26524b 96 Tests
EUR 928

Porcine Scavenger mRNA- decapping enzyme DcpS, DCPS ELISA KIT

ELI-07878p 96 Tests
EUR 928

Rat Scavenger mRNA- decapping enzyme DcpS, Dcps ELISA KIT

ELI-32404r 96 Tests
EUR 886

Mouse Scavenger mRNA- decapping enzyme DcpS, Dcps ELISA KIT

ELI-48380m 96 Tests
EUR 865

DCP1B sgRNA CRISPR Lentivector (Human) (Target 1)

K0566402 1.0 ug DNA
EUR 154

DCP1B sgRNA CRISPR Lentivector (Human) (Target 2)

K0566403 1.0 ug DNA
EUR 154

DCP1B sgRNA CRISPR Lentivector (Human) (Target 3)

K0566404 1.0 ug DNA
EUR 154

Dcp1b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3596802 1.0 ug DNA
EUR 154

Dcp1b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3596803 1.0 ug DNA
EUR 154

Dcp1b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3596804 1.0 ug DNA
EUR 154

DCP1B Protein Vector (Mouse) (pPB-C-His)

PV170838 500 ng
EUR 603

DCP1B Protein Vector (Mouse) (pPB-N-His)

PV170839 500 ng
EUR 603

DCP1B Protein Vector (Mouse) (pPM-C-HA)

PV170840 500 ng
EUR 603

DCP1B Protein Vector (Mouse) (pPM-C-His)

PV170841 500 ng
EUR 603

DCP1B Protein Vector (Human) (pPB-C-His)

PV011781 500 ng
EUR 329

DCP1B Protein Vector (Human) (pPB-N-His)

PV011782 500 ng
EUR 329

DCP1B Protein Vector (Human) (pPM-C-HA)

PV011783 500 ng
EUR 329

DCP1B Protein Vector (Human) (pPM-C-His)

PV011784 500 ng
EUR 329

Dcp1b 3'UTR GFP Stable Cell Line

TU154905 1.0 ml Ask for price

Dcp1b 3'UTR Luciferase Stable Cell Line

TU104905 1.0 ml Ask for price

Dcp1b 3'UTR Luciferase Stable Cell Line

TU203203 1.0 ml Ask for price

Dcp1b 3'UTR GFP Stable Cell Line

TU253203 1.0 ml Ask for price

DCP1B 3'UTR GFP Stable Cell Line

TU055629 1.0 ml
EUR 1394

DCP1B 3'UTR Luciferase Stable Cell Line

TU005629 1.0 ml
EUR 1394

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-100ug

QP8201-ec-100ug 100ug
EUR 571

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-10ug

QP8201-ec-10ug 10ug
EUR 272

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-1mg

QP8201-ec-1mg 1mg
EUR 2303

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-200ug

QP8201-ec-200ug 200ug
EUR 898

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-500ug

QP8201-ec-500ug 500ug
EUR 1514

Recombinant Human mRNA-decapping enzyme 1A Protein, His, E.coli-50ug

QP8201-ec-50ug 50ug
EUR 362

pPACK-ID: Integrase-defective lentiviral packaging mix (15 reactions)

LV520A-ID 15 reactions
EUR 697
  • Category: Lentiviral Technology

pPACK-ID: Integrase-defective lentiviral packaging mix (30 reactions)

LV525A-ID 30 reactions
EUR 1132
  • Category: Lentiviral Technology

Decapping Enzyme, Scavenger (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Human Decapping Enzyme, Scavenger

7-02632 2µg Ask for price

Recombinant Human Decapping Enzyme, Scavenger

7-02633 10µg Ask for price

Recombinant Human Decapping Enzyme, Scavenger

7-02634 1mg Ask for price

Decapping Enzyme, Scavenger (DCPS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Decapping Enzyme, Scavenger (DCPS) Antibody

abx029282-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Decapping Enzyme, Scavenger (DCPS) Antibody

abx029282-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Enhancer of mRNA-Decapping 3 (EDC3) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Enhancer Of mRNA-Decapping 4 (EDC4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Enhancer of mRNA-Decapping 3 (EDC3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *